Have questions? Visit https://www.reddit.com/r/SNPedia

rs863223524

From SNPedia

ClinVar
Risk
Alt
Reference Rs863223524(GGGAGCCGCTGGGCTCGGAGGACTC;GGGAGCCGCTGGGCTCGGAGGACTC)
Significance Pathogenic
Disease not provided
Variation info
Gene ELN
CLNDBN not provided
Reversed 0
HGVS NC_000007.13:g.73477960_73477984del25
CLNSRC
CLNACC RCV000197740.1,