Have questions? Visit https://www.reddit.com/r/SNPedia

rs863223661

From SNPedia

ClinVar
Risk rs863223661(;)
Alt rs863223661(;)
Reference rs863223661(GCAGCGATGCGTTCCCCACGGACGCGCGGC;GCAGCGATGCGTTCCCCACGGACGCGCGGC)
Significance Pathogenic
Disease not provided
Variation info
Gene
CLNDBN not provided
Reversed 1
HGVS NC_000020.10:g.10654155_10654184del30
CLNSRC
CLNACC RCV000197916.1,