Have questions? Visit https://www.reddit.com/r/SNPedia

rs863223782

From SNPedia

ClinVar
Risk rs863223782(;)
Alt rs863223782(;)
Reference rs863223782(AAAGCTGAGCCCGCCATGCCTGGCCGC;AAAGCTGAGCCCGCCATGCCTGGCCGC)
Significance Probable-Pathogenic
Disease not provided
Variation info
Gene TBX5
CLNDBN not provided
Reversed 1
HGVS NC_000012.11:g.114836486_114836512del27
CLNSRC
CLNACC RCV000195513.1,