Have questions? Visit https://www.reddit.com/r/SNPedia

rs863223784

From SNPedia

ClinVar
Risk rs863223784(CCAGGA;CCAGGA)
Alt rs863223784(CCAGGA;CCAGGA)
Reference rs863223784(TCCCCCGCCACCGGGGCGCATTG;TCCCCCGCCACCGGGGCGCATTG)
Significance Pathogenic
Disease not provided
Variation info
Gene TBX5
CLNDBN not provided
Reversed 1
HGVS NC_000012.11:g.114836445_114836467del23insTCCTGG
CLNSRC
CLNACC RCV000199954.1,