Have questions? Visit https://www.reddit.com/r/SNPedia

rs863223985

From SNPedia

ClinVar
Risk rs863223985(;)
Alt rs863223985(;)
Reference rs863223985(CGCAGCTGGAGGCACTGCTGT;CGCAGCTGGAGGCACTGCTGT)
Significance Pathogenic
Disease not provided
Variation info
Gene FH
CLNDBN not provided
Reversed 1
HGVS NC_000001.10:g.241669371_241669391del21
CLNSRC
CLNACC RCV000195479.1,