Have questions? Visit https://www.reddit.com/r/SNPedia

rs863224229

From SNPedia

ClinVar
Risk rs863224229(;)
Alt rs863224229(;)
Reference rs863224229(GGCCGGGTGCGATGGCGGCGGTGG;GGCCGGGTGCGATGGCGGCGGTGG)
Significance Pathogenic
Disease not provided
Variation info
Gene SURF2 SURF1
CLNDBN not provided
Reversed 1
HGVS NC_000009.11:g.136223317_136223340del24
CLNSRC
CLNACC RCV000199102.1,