Have questions? Visit https://www.reddit.com/r/SNPedia

rs863224480

From SNPedia

ClinVar
Risk rs863224480(;)
Alt rs863224480(;)
Reference rs863224480(ATAAAACCCTAGCCTTCAAA;ATAAAACCCTAGCCTTCAAA)
Significance Pathogenic
Disease Lynch syndrome
Variation info
Gene MLH1
CLNDBN Lynch syndrome
Reversed 0
HGVS NC_000003.11:g.37055949_37055968del20
CLNSRC
CLNACC RCV000195440.1,