Have questions? Visit https://www.reddit.com/r/SNPedia

rs863224965

From SNPedia

ClinVar
Risk rs863224965(;)
Alt rs863224965(;)
Reference rs863224965(GGTTCCTACGAAGCTCTGAAA;GGTTCCTACGAAGCTCTGAAA)
Significance Pathogenic
Disease Limb-girdle muscular dystrophy
Variation info
Gene CAPN3
CLNDBN Limb-girdle muscular dystrophy, type 2A
Reversed 0
HGVS NC_000015.9:g.42681136_42681156del21
CLNSRC Quest Diagnostics
CLNACC RCV000201156.1,