Have questions? Visit https://www.reddit.com/r/SNPedia

rs863225061

From SNPedia

ClinVar
Risk rs863225061(;)
Alt rs863225061(;)
Reference rs863225061(ATTTTCGGTAAGTGATGGTCAGAG;ATTTTCGGTAAGTGATGGTCAGAG)
Significance Pathogenic
Disease Ornithine carbamoyltransferase deficiency
Variation info
Gene OTC
CLNDBN Ornithine carbamoyltransferase deficiency
Reversed 0
HGVS NC_000023.10:g.38212021_38212044del24
CLNSRC
CLNACC RCV000201257.1,