Have questions? Visit https://www.reddit.com/r/SNPedia

rs864309477

From SNPedia

ClinVar
Risk rs864309477(;)
Alt rs864309477(;)
Reference rs864309477(AGAGAGGTCACCCAGGCCCCCCGGGGC;AGAGAGGTCACCCAGGCCCCCCGGGGC)
Significance Pathogenic
Disease Stickler syndrome
Variation info
Gene COL11A2
CLNDBN Stickler syndrome, type 3
Reversed 1
HGVS NC_000006.11:g.33140357_33140383del27
CLNSRC OMIM Allelic Variant
CLNACC RCV000018659.28,