Have questions? Visit https://www.reddit.com/r/SNPedia

rs864309482

From SNPedia

ClinVar
Risk rs864309482(AA;AA)
Alt rs864309482(AA;AA)
Reference rs864309482(TAGAGTGTGGGCCTCAGGAG;TAGAGTGTGGGCCTCAGGAG)
Significance Pathogenic
Disease Unverricht-Lundborg syndrome
Variation info
Gene CSTB
CLNDBN Unverricht-Lundborg syndrome
Reversed 1
HGVS NC_000021.8:g.45194518_45194537del20insTT
CLNSRC
CLNACC RCV000202486.1,