Have questions? Visit https://www.reddit.com/r/SNPedia

rs864621965

From SNPedia

ClinVar
Risk
Alt
Reference Rs864621965(CGACTGTCCAGGACACCGATGTCTCAATGGGGGGACATGCGTGGA;CGACTGTCCAGGACACCGATGTCTCAATGGGGGGACATGCGTGGA)
Significance Pathogenic
Disease Cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy
Variation info
Gene NOTCH3
CLNDBN Cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy
Reversed 1
HGVS NC_000019.9:g.15302600_15302644del45
CLNSRC OMIM Allelic Variant
CLNACC RCV000009803.4,