Have questions? Visit https://www.reddit.com/r/SNPedia

rs864622436

From SNPedia

ClinVar
Risk rs864622436(;)
Alt rs864622436(;)
Reference rs864622436(TTCGATTTGCAGCAAATTGACTTCTTTA;TTCGATTTGCAGCAAATTGACTTCTTTA)
Significance Probable-Pathogenic
Disease Lynch syndrome
Variation info
Gene MSH2
CLNDBN Lynch syndrome
Reversed 0
HGVS NC_000002.11:g.47698092_47698119del28
CLNSRC
CLNACC RCV000204865.1,