Have questions? Visit https://www.reddit.com/r/SNPedia

rs864622583

From SNPedia

ClinVar
Risk rs864622583(;)
Alt rs864622583(;)
Reference rs864622583(GGGTTGTTACATTCAAAAAAACTGCGGCAAGTTCT;GGGTTGTTACATTCAAAAAAACTGCGGCAAGTTCT)
Significance Pathogenic
Disease Gorlin syndrome
Variation info
Gene PTCH1
CLNDBN Gorlin syndrome
Reversed 1
HGVS NC_000009.11:g.98268779_98268813del35
CLNSRC
CLNACC RCV000205973.1,