Have questions? Visit https://www.reddit.com/r/SNPedia

rs876657397

From SNPedia

ClinVar
Risk
Alt
Reference Rs876657397(GGTGCTCCTGCTGCCGCTCCTGCT;GGTGCTCCTGCTGCCGCTCCTGCT)
Significance Pathogenic
Disease Alport syndrome
Variation info
Gene COL4A3 COL4A4
CLNDBN Alport syndrome, autosomal recessive
Reversed 0
HGVS NC_000002.11:g.228029482_228029505del24
CLNSRC OMIM Allelic Variant
CLNACC RCV000172875.2,