Have questions? Visit https://www.reddit.com/r/SNPedia

rs876658358

From SNPedia

ClinVar
Risk rs876658358(AAGGTACAAT;AAGGTACAAT)
Alt rs876658358(AAGGTACAAT;AAGGTACAAT)
Reference rs876658358(TGCCAGGAGCTGCATAAACATTC;TGCCAGGAGCTGCATAAACATTC)
Significance Pathogenic
Disease Tumor susceptibility linked to germline BAP1 mutations
Variation info
Gene PALB2
CLNDBN Tumor susceptibility linked to germline BAP1 mutations
Reversed 1
HGVS NC_000016.9:g.23640971_23640993del23insATTGTACCTT
CLNSRC
CLNACC RCV000216440.1,