rs876658358

From SNPedia

ClinVar
Risk rs876658358(AAGGTACAAT;AAGGTACAAT)
Alt rs876658358(AAGGTACAAT;AAGGTACAAT)
Reference Rs876658358(TGCCAGGAGCTGCATAAACATTC;TGCCAGGAGCTGCATAAACATTC)
Significance Pathogenic
Disease Hereditary cancer-predisposing syndrome
Variation info
Gene PALB2
CLNDBN Hereditary cancer-predisposing syndrome
Reversed 1
HGVS NC_000016.9:g.23640971_23640993del23insATTGTACCTT
CLNSRC
CLNACC RCV000216440.1,