Have questions? Visit https://www.reddit.com/r/SNPedia

rs876658511

From SNPedia

ClinVar
Risk
Alt
Reference Rs876658511(GTGGCGGAGCTGCTGCTGCTCCACGGCGCGGAGCCCAA;GTGGCGGAGCTGCTGCTGCTCCACGGCGCGGAGCCCAA)
Significance Pathogenic
Disease Hereditary cancer-predisposing syndrome
Variation info
Gene CDKN2A
CLNDBN Hereditary cancer-predisposing syndrome
Reversed 1
HGVS NC_000009.11:g.21971146_21971183del38
CLNSRC
CLNACC RCV000222672.1,