Have questions? Visit https://www.reddit.com/r/SNPedia

rs876659040

From SNPedia

ClinVar
Risk rs876659040(TCCGGGAACGAGCCTCGTTCCGCGT;TCCGGGAACGAGCCTCGTTCCGCGT)
Alt rs876659040(TCCGGGAACGAGCCTCGTTCCGCGT;TCCGGGAACGAGCCTCGTTCCGCGT)
Reference rs876659040(GC;GC)
Significance Pathogenic
Disease Tumor susceptibility linked to germline BAP1 mutations
Variation info
Gene LOC101928103 BARD1
CLNDBN Tumor susceptibility linked to germline BAP1 mutations
Reversed 1
HGVS NC_000002.11:g.215674224_215674225delGCinsACGCGGAACGAGGCTCGTTCCCGGA
CLNSRC
CLNACC RCV000220228.1,