Have questions? Visit https://www.reddit.com/r/SNPedia

rs876659260

From SNPedia

ClinVar
Risk rs876659260(;)
Alt rs876659260(;)
Reference rs876659260(ACAGTTCCTGCATGGGCGGCA;ACAGTTCCTGCATGGGCGGCA)
Significance Probable-Pathogenic
Disease Tumor susceptibility linked to germline BAP1 mutations
Variation info
Gene TP53
CLNDBN Tumor susceptibility linked to germline BAP1 mutations
Reversed 1
HGVS NC_000017.10:g.7577545_7577565del21
CLNSRC
CLNACC RCV000222616.1,