Have questions? Visit https://www.reddit.com/r/SNPedia

rs876659293

From SNPedia

ClinVar
Risk rs876659293(;)
Alt rs876659293(;)
Reference rs876659293(TACTTGCCAAGGCAAGATCT;TACTTGCCAAGGCAAGATCT)
Significance Pathogenic
Disease Tumor susceptibility linked to germline BAP1 mutations
Variation info
Gene BRCA1
CLNDBN Tumor susceptibility linked to germline BAP1 mutations
Reversed 1
HGVS NC_000017.10:g.41226350_41226369del20
CLNSRC
CLNACC RCV000217564.1,