Have questions? Visit https://www.reddit.com/r/SNPedia

rs876660574

From SNPedia

ClinVar
Risk rs876660574(;)
Alt rs876660574(;)
Reference rs876660574(ATCACTGTGCAGCAGCAATCTT;ATCACTGTGCAGCAGCAATCTT)
Significance Pathogenic
Disease Tumor susceptibility linked to germline BAP1 mutations
Variation info
Gene PALB2
CLNDBN Tumor susceptibility linked to germline BAP1 mutations
Reversed 1
HGVS NC_000016.9:g.23614946_23614967del22
CLNSRC
CLNACC RCV000214247.1,