Have questions? Visit https://www.reddit.com/r/SNPedia

rs876661296

From SNPedia

ClinVar
Risk rs876661296(;)
Alt rs876661296(;)
Reference rs876661296(GTCCCCAAGCTGCGCCAGGCT;GTCCCCAAGCTGCGCCAGGCT)
Significance Pathogenic
Disease Hypercalcemia
Variation info
Gene SLC34A1
CLNDBN Hypercalcemia, infantile, 2
Reversed 0
HGVS NC_000005.9:g.176813234_176813254del21
CLNSRC OMIM Allelic Variant
CLNACC RCV000223670.1,