Have questions? Visit https://www.reddit.com/r/SNPedia

rs876661302

From SNPedia

ClinVar
Risk rs876661302(;)
Alt rs876661302(;)
Reference rs876661302(CGAGCTCCAGGCCCAGATCGC;CGAGCTCCAGGCCCAGATCGC)
Significance Pathogenic
Disease May-Hegglin anomaly Sebastian syndrome
Variation info
Gene MYH9
CLNDBN May-Hegglin anomaly Sebastian syndrome
Reversed 1
HGVS NC_000022.10:g.36692946_36692966del21
CLNSRC OMIM Allelic Variant
CLNACC RCV000015139.25, RCV000015140.25,