Have questions? Visit https://www.reddit.com/r/SNPedia

rs878853252

From SNPedia

ClinVar
Risk rs878853252(CTCCCTCCTCAGCTCCTCCAGG;CTCCCTCCTCAGCTCCTCCAGG)
Alt rs878853252(CTCCCTCCTCAGCTCCTCCAGG;CTCCCTCCTCAGCTCCTCCAGG)
Reference rs878853252(;)
Significance Pathogenic
Disease Neurodevelopmental disorder with or without anomalies of the brain
Variation info
Gene RERE
CLNDBN Neurodevelopmental disorder with or without anomalies of the brain, eye, or heart
Reversed 1
HGVS NC_000001.10:g.8421297_8421318dup22
CLNSRC OMIM Allelic Variant
CLNACC RCV000225146.1,