Have questions? Visit https://www.reddit.com/r/SNPedia

rs878854272

From SNPedia

ClinVar
Risk rs878854272(;)
Alt rs878854272(;)
Reference rs878854272(CGAGGTGAGTGTATACAAAA;CGAGGTGAGTGTATACAAAA)
Significance Pathogenic
Disease Primary pulmonary hypertension
Variation info
Gene BMPR2
CLNDBN Primary pulmonary hypertension
Reversed 0
HGVS NC_000002.11:g.203395674_203395693del20
CLNSRC
CLNACC RCV000226914.1,