Have questions? Visit https://www.reddit.com/r/SNPedia

rs878854335

From SNPedia

ClinVar
Risk rs878854335(AACTTAGTGAACCAAGCCCTCCT;AACTTAGTGAACCAAGCCCTCCT)
Alt rs878854335(AACTTAGTGAACCAAGCCCTCCT;AACTTAGTGAACCAAGCCCTCCT)
Reference rs878854335(;)
Significance Pathogenic
Disease Dilated cardiomyopathy 1G
Variation info
Gene TTN TTN-AS1
CLNDBN Dilated cardiomyopathy 1G
Reversed 1
HGVS NC_000002.11:g.179434679_179434680insAGGAGGGCTTGGTTCACTAAGTT
CLNSRC
CLNACC RCV000228009.1,