Have questions? Visit https://www.reddit.com/r/SNPedia

rs878854345

From SNPedia

ClinVar
Risk rs878854345(GCGGCGGCTGCGGCGGCGGCA;GCGGCGGCTGCGGCGGCGGCA)
Alt rs878854345(GCGGCGGCTGCGGCGGCGGCA;GCGGCGGCTGCGGCGGCGGCA)
Reference rs878854345(;)
Significance Pathogenic
Disease Syndactyly
Variation info
Gene HOXD13
CLNDBN Syndactyly, type V
Reversed 0
HGVS NC_000002.11:g.176957827_176957828insGGCTGCGGCGGCGGCAGCGGC
CLNSRC OMIM Allelic Variant
CLNACC RCV000016001.25,