Have questions? Visit https://www.reddit.com/r/SNPedia

rs878854346

From SNPedia

ClinVar
Risk rs878854346(;)
Alt rs878854346(;)
Reference rs878854346(GCGGCGGCGGCAGCGGCGGCT;GCGGCGGCGGCAGCGGCGGCT)
Significance Pathogenic
Disease Brachydactyly-syndactyly syndrome
Variation info
Gene HOXD13
CLNDBN Brachydactyly-syndactyly syndrome
Reversed 0
HGVS NC_000002.11:g.176957801_176957821del21
CLNSRC OMIM Allelic Variant
CLNACC RCV000016003.29,