Have questions? Visit https://www.reddit.com/r/SNPedia

rs878855140

From SNPedia

ClinVar
Risk rs878855140(TATATCAAATTGATATTTCAACAAC;TATATCAAATTGATATTTCAACAAC)
Alt rs878855140(TATATCAAATTGATATTTCAACAAC;TATATCAAATTGATATTTCAACAAC)
Reference rs878855140(;)
Significance Pathogenic
Disease Familial cancer of breast Fanconi anemia
Variation info
Gene BRIP1
CLNDBN Familial cancer of breast Fanconi anemia, complementation group J
Reversed 1
HGVS NC_000017.10:g.59858297_59858298insGTTGTTGAAATATCAATTTGATATA
CLNSRC
CLNACC RCV000232677.1,