Have questions? Visit https://www.reddit.com/r/SNPedia

rs878855331

From SNPedia

ClinVar
Risk
Alt
Reference Rs878855331(TCCCCACATCCCTACCAGCTTCCACAGGCCTTGG;TCCCCACATCCCTACCAGCTTCCACAGGCCTTGG)
Significance Probable-Pathogenic
Disease Ceroid lipofuscinosis neuronal 2
Variation info
Gene TPP1
CLNDBN Ceroid lipofuscinosis neuronal 2
Reversed 1
HGVS NC_000011.9:g.6638550_6638583del34
CLNSRC Institute of Human Genetics
CLNACC RCV000234817.1,