Have questions? Visit https://www.reddit.com/r/SNPedia

SL20284 137

From SNPedia

SL20284 137
Plant Solanaceae
SNP name SL10003_496
UCD contig 30319391
GenBank ID CD002653
Primer SL10003
Product size 1170
Forward Primer GGCCGAGTTGCTCTTTCTC
tmF 60.09
Reverse Primer AAACTCAGATTCACGCCCAG
tmR 60.26
Position 496
5prime Flanking sequence AGTTTATAAGAATACTAATTACTAGGTAAC
Base1 A
Base2 G
3prime Flanking Sequence TGACTTGGTCGACCAGCCAAAGATGCAGAT


This is our first plant snp. Based on [PMID 18088428]