Have questions? Visit https://www.reddit.com/r/SNPedia

SLC18A2

From SNPedia
(Redirected from VMAT2)

is agene
is mentioned by
Full namesolute carrier family 18 (vesicular monoamine), member 2
Other namesVMAT2
RelatedSLC22A3
EntrezGene6571
PheGenI6571
VariationViewer6571
ClinVarSLC18A2
GeneCardsSLC18A2
dbSNP6571
SADR6571
HugeNav6571
wikipediaSLC18A2
googleSLC18A2
gopubmedSLC18A2
EVSSLC18A2
HEFalMpSLC18A2
MyGene2SLC18A2
23andMeSLC18A2
UniProtQ05940
EnsemblENSG00000165646
OMIM193001
# SNPs6
 Max MagnitudeChromosome positionSummary
rs2015586117,262,226
rs363224117,263,062
rs363227117,267,055
rs363276117,274,298
rs3633870117,244,053
rs60912143117,241,017

[PMID 16339215] identified 6 SLC18A2 promoter variants (listed below w/ position listed relative to the start of transcription [ch10:118,990,624 - human genome release may 2004], the haplotypes associated with increased transcriptional activity over the reference (no variants) were associated with lower observed Parkinson's disease risk

variant name dbSNP rs# variation position sequence context freq AA freq CAU freq notes
VMAT.1 none G/T -219 CTCTTCCCCAGGCCTGGGTCC 0.01 0.01 0.00 no noted effects, haplotype consisted only of .1
VMAT.2 none G/A -112 CAGCGACGGCGCGGGCGGGCG 0.01 0.01 0.00 .4 + .2 haplotype, no noted effects
VMAT.3 rs60912143 G/A -106 CGGCGCGGGCGGGCGGAGGCC 0.10 0.16 0.04 .4 + .3 denoted the only reduced (~50%) transcription haplotype observed
VMAT.4 none C/A -103 CGCGGGCGGGCGGAGGCCGGG 0.47 0.61 0.32 .4 haplotype, increased (~120%) transcriptional activity
VMAT.5 rs12412905 C/T -74 GCCCCCCGCCCCCGCTCCCTC 0.05 0.06 0.04 .5 + .4 haplotype, highest observed (~140%) transcription haplotype
VMAT.6 rs60543597 G/A -62 CGCTCCCTCCGGCCGTGACGT 0.15 0.07 0.23 .6 + .4 haplotype, higher (~130%) transcription haplotype