Have questions? Visit https://www.reddit.com/r/SNPedia

rs1057516166

From SNPedia

ClinVar
Risk rs1057516166(CTCACCCATGCCCTATGCCTCC;CTCACCCATGCCCTATGCCTCC)
Alt rs1057516166(CTCACCCATGCCCTATGCCTCC;CTCACCCATGCCCTATGCCTCC)
Reference Rs1057516166(-;-)
Significance Pathogenic
Disease Blepharophimosis
Variation info
Gene FOXL2 C3orf72 FOXL2NB
CLNDBN Blepharophimosis, ptosis, and epicanthus inversus
Reversed 1
HGVS NC_000003.11:g.138664914_138664935dup22
CLNSRC
CLNACC RCV000408822.1,