Have data from 23andMe or Ancestry? Make a report automatically with Promethease !

rs1057516170

From SNPedia

ClinVar
Risk rs1057516170(-;-)
Alt rs1057516170(-;-)
Reference Rs1057516170(CGGCAGCCGCAGCGGCTGCAGCAGCTGC;CGGCAGCCGCAGCGGCTGCAGCAGCTGC)
Significance Pathogenic
Disease Blepharophimosis
Variation info
Gene FOXL2 C3orf72 FOXL2NB
CLNDBN Blepharophimosis, ptosis, and epicanthus inversus
Reversed 1
HGVS NC_000003.11:g.138664876_138664903del28
CLNSRC
CLNACC RCV000408843.1,