Have data from 23andMe or Ancestry? Make a report automatically with Promethease !

rs1057516172

From SNPedia

ClinVar
Risk rs1057516172(-;-)
Alt rs1057516172(-;-)
Reference Rs1057516172(CGGCTGCAGCAGCTGCGGCTGC;CGGCTGCAGCAGCTGCGGCTGC)
Significance Pathogenic
Disease Blepharophimosis
Variation info
Gene FOXL2 C3orf72 FOXL2NB
CLNDBN Blepharophimosis, ptosis, and epicanthus inversus
Reversed 1
HGVS NC_000003.11:g.138664870_138664891del22
CLNSRC
CLNACC RCV000408845.1,