Have questions? Visit https://www.reddit.com/r/SNPedia

rs1057516174

From SNPedia
ClinVar
Risk rs1057516174(-;-)
Alt rs1057516174(-;-)
Reference Rs1057516174(TGCAGCAGCTGCGGCTGCAGCCGCGGGC;TGCAGCAGCTGCGGCTGCAGCCGCGGGC)
Significance Pathogenic
Disease Blepharophimosis
Variation info
Gene FOXL2 FOXL2NB C3orf72 LINC01391
CLNDBN Blepharophimosis, ptosis, and epicanthus inversus
Reversed 1
HGVS NC_000003.11:g.138664860_138664887del28
CLNSRC
CLNACC RCV000408791.1,