Have data from 23andMe or Ancestry? Make a report automatically with Promethease !

rs1057516182

From SNPedia

ClinVar
Risk rs1057516182(GCCGCACCGCCGCCTGCCCC;GCCGCACCGCCGCCTGCCCC)
Alt rs1057516182(GCCGCACCGCCGCCTGCCCC;GCCGCACCGCCGCCTGCCCC)
Reference Rs1057516182(-;-)
Significance Pathogenic
Disease Blepharophimosis
Variation info
Gene FOXL2 FOXL2NB C3orf72 LINC01391
CLNDBN Blepharophimosis, ptosis, and epicanthus inversus
Reversed 1
HGVS NC_000003.11:g.138664639_138664658dup20
CLNSRC
CLNACC RCV000408783.1,