Have questions? Visit https://www.reddit.com/r/SNPedia

rs1057516762

From SNPedia

ClinVar
Risk rs1057516762(-;-)
Alt rs1057516762(-;-)
Reference Rs1057516762(GTGGGCAATCGGTCCTGTGACATTGTGAACTT;GTGGGCAATCGGTCCTGTGACATTGTGAACTT)
Significance Probable-Pathogenic
Disease Autosomal recessive polycystic kidney disease
Variation info
Gene PKHD1
CLNDBN Autosomal recessive polycystic kidney disease
Reversed 1
HGVS NC_000006.11:g.51890883_51890914del32
CLNSRC
CLNACC RCV000409814.1,