Have questions? Visit https://www.reddit.com/r/SNPedia

rs1057516874

From SNPedia
ClinVar
Risk rs1057516874(-;-)
Alt rs1057516874(-;-)
Reference Rs1057516874(TCCCCACAGTCCCCGCGGTTCATTGG;TCCCCACAGTCCCCGCGGTTCATTGG)
Significance Probable-Pathogenic
Disease Segawa syndrome
Variation info
Gene TH
CLNDBN Segawa syndrome, autosomal recessive
Reversed 1
HGVS NC_000011.9:g.2191085_2191110del26
CLNSRC
CLNACC RCV000409032.1,