Have data from 23andMe or Ancestry? Make a report automatically with Promethease !

rs1057517205

From SNPedia

ClinVar
Risk rs1057517205(-;-)
Alt rs1057517205(-;-)
Reference Rs1057517205(GGCGGGCGCGGGAAGATGGCGGC;GGCGGGCGCGGGAAGATGGCGGC)
Significance Probable-Pathogenic
Disease Limb-girdle muscular dystrophy
Variation info
Gene
CLNDBN Limb-girdle muscular dystrophy, type 2E
Reversed 1
HGVS NC_000004.11:g.52904418_52904440del23
CLNSRC
CLNACC RCV000412344.1,