Have data from 23andMe or Ancestry? Make a report automatically with Promethease !

rs1057517337

From SNPedia

ClinVar
Risk rs1057517337(-;-)
Alt rs1057517337(-;-)
Reference Rs1057517337(GGCCCCCTGCTGCTCGCGCT;GGCCCCCTGCTGCTCGCGCT)
Significance Probable-Pathogenic
Disease Infantile hypophosphatasia
Variation info
Gene ALPL
CLNDBN Infantile hypophosphatasia
Reversed 0
HGVS NC_000001.10:g.21904096_21904115del20
CLNSRC
CLNACC RCV000411326.1,