Have questions? Visit https://www.reddit.com/r/SNPedia

rs1057518732

From SNPedia

ClinVar
Risk rs1057518732(AGGTAGAACCTTATCTGCCATCTTC;AGGTAGAACCTTATCTGCCATCTTC)
Alt rs1057518732(AGGTAGAACCTTATCTGCCATCTTC;AGGTAGAACCTTATCTGCCATCTTC)
Reference Rs1057518732(-;-)
Significance Pathogenic
Disease Autosomal recessive severe congenital neutropenia Specific granule deficiency Specific granule deficiency 2
Variation info
Gene SMARCD2
CLNDBN Autosomal recessive severe congenital neutropenia Specific granule deficiency Specific granule deficiency 2
Reversed 1
HGVS NC_000017.10:g.61914561_61914585dup25
CLNSRC OMIM Allelic Variant
CLNACC RCV000415478.1, RCV000490559.1,