Have data from 23andMe or Ancestry? Make a report automatically with Promethease !

rs1057518787

From SNPedia

ClinVar
Risk rs1057518787(-;-)
Alt rs1057518787(-;-)
Reference Rs1057518787(GCGCCTAGGGACCTTCTGCTGCCCC;GCGCCTAGGGACCTTCTGCTGCCCC)
Significance Probable-Pathogenic
Disease Nystagmus Ocular albinism Poor eye contact
Variation info
Gene GPR143
CLNDBN Nystagmus Ocular albinism Poor eye contact
Reversed 1
HGVS NC_000023.10:g.9733822_9733846del25
CLNSRC
CLNACC RCV000414936.1,