Have questions? Visit https://www.reddit.com/r/SNPedia

rs1057519483

From SNPedia
ClinVar
Risk rs1057519483(-;-)
Alt rs1057519483(-;-)
Reference Rs1057519483(CGCTACCCGGACATGTCCACAC;CGCTACCCGGACATGTCCACAC)
Significance Pathogenic
Disease Axenfeld-Rieger syndrome type 1
Variation info
Gene PITX2
CLNDBN Axenfeld-Rieger syndrome type 1
Reversed 1
HGVS NC_000004.11:g.111542367_111542388del22
CLNSRC
CLNACC RCV000416516.1,