Have data from 23andMe or Ancestry? Make a report automatically with Promethease !

rs1057519487

From SNPedia

ClinVar
Risk rs1057519487(-;-)
Alt rs1057519487(-;-)
Reference Rs1057519487(GACAGGCGTCCCGGGCTCCAGT;GACAGGCGTCCCGGGCTCCAGT)
Significance Pathogenic
Disease Axenfeld-Rieger syndrome type 1
Variation info
Gene PITX2
CLNDBN Axenfeld-Rieger syndrome type 1
Reversed 1
HGVS NC_000004.11:g.111539521_111539542del22
CLNSRC
CLNACC RCV000416543.1,