Have questions? Visit https://www.reddit.com/r/SNPedia

rs1057519587

From SNPedia
ClinVar
Risk rs1057519587(-;-)
Alt rs1057519587(-;-)
Reference Rs1057519587(AGGTCTTAGACCTATTCCTGAAGCA;AGGTCTTAGACCTATTCCTGAAGCA)
Significance Pathogenic
Disease Microcephaly
Variation info
Gene NBN
CLNDBN Microcephaly, normal intelligence and immunodeficiency
Reversed 1
HGVS NC_000008.10:g.90976708_90976732del25
CLNSRC
CLNACC RCV000417085.1,