Have questions? Visit https://www.reddit.com/r/SNPedia

rs1057519835

From SNPedia

ClinVar
Risk rs1057519835(-;-)
Alt rs1057519835(-;-)
Reference Rs1057519835(ACTGGCAGCAACAGTCTTACCTGG;ACTGGCAGCAACAGTCTTACCTGG)
Significance Probable-Pathogenic
Disease Malignant melanoma
Variation info
Gene CTNNB1
CLNDBN Malignant melanoma
Reversed 0
HGVS NC_000003.11:g.41266076_41266099delTGGCAGCAACAGTCTTACCTGGAC
CLNSRC
CLNACC RCV000431125.1,