Have questions? Visit https://www.reddit.com/r/SNPedia

rs1057520307

From SNPedia

ClinVar
Risk rs1057520307(-;-)
Alt rs1057520307(-;-)
Reference Rs1057520307(AACATGCCATCGACTCCGCTG;AACATGCCATCGACTCCGCTG)
Significance Pathogenic
Disease Oocyte maturation defect 2
Variation info
Gene TUBB8
CLNDBN Oocyte maturation defect 2
Reversed 1
HGVS NC_000010.10:g.94810_94830del21
CLNSRC OMIM Allelic Variant
CLNACC RCV000419031.1,