Have data from 23andMe or Ancestry? Make a report automatically with Promethease !

rs1064792890

From SNPedia

ClinVar
Risk rs1064792890(-;-)
Alt rs1064792890(-;-)
Reference Rs1064792890(GACGGCCCCGCGCTCAGCGG;GACGGCCCCGCGCTCAGCGG)
Significance Pathogenic
Disease Mitochondrial DNA depletion syndrome 1 (MNGIE type)
Variation info
Gene SCO2 TYMP
CLNDBN Mitochondrial DNA depletion syndrome 1 (MNGIE type)
Reversed 1
HGVS NC_000022.10:g.50964302_50964321del20
CLNSRC
CLNACC RCV000208691.1,