Have questions? Visit https://www.reddit.com/r/SNPedia

rs1064792906

From SNPedia
ClinVar
Risk rs1064792906(-;-)
Alt rs1064792906(-;-)
Reference Rs1064792906(TCTATGCCCGCTTCACCGCCC;TCTATGCCCGCTTCACCGCCC)
Significance Probable-Pathogenic
Disease Multiple endocrine neoplasia not provided
Variation info
Gene MEN1
CLNDBN Multiple endocrine neoplasia, type 1 not provided
Reversed 1
HGVS NC_000011.9:g.64577296_64577316del21
CLNSRC
CLNACC RCV000460992.1, RCV000478848.1,